pJB066
(Plasmid
#98913)
-
PurposeExpress FtsZ tagged with pAmCherry1 in E coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98913 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDR175
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFtsZ
-
SpeciesE. coli
-
Insert Size (bp)1149
-
GenBank IDNC_000913.3
- Promoter pBAD
-
Tag
/ Fusion Protein
- pAmCherry1 (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTTTAAGAAGGAGATATACG
- 3′ sequencing primer CTTTACTAAGCTTGCATGCCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJB066 was a gift from Jie Xiao (Addgene plasmid # 98913 ; http://n2t.net/addgene:98913 ; RRID:Addgene_98913) -
For your References section:
A multi-layered protein network stabilizes the Escherichia coli FtsZ-ring and modulates constriction dynamics. Buss J, Coltharp C, Shtengel G, Yang X, Hess H, Xiao J. PLoS Genet. 2015 Apr 7;11(4):e1005128. doi: 10.1371/journal.pgen.1005128. eCollection 2015 Apr. PGENETICS-D-14-03238 [pii] PubMed 25848771