pJB089
(Plasmid
#98914)
-
PurposeExpress Dronpa tagged ZapA and pAmCherry1 tagged FtsZ in E coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98914 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCA24N
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameFtsZ
-
SpeciesE. coli
-
Insert Size (bp)1149
-
GenBank IDNC_000913.3
- Promoter T5-lac
-
Tag
/ Fusion Protein
- pAmCherry1 (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AAGCGCATTCTGAGCTGCC
- 3′ sequencing primer gctaattaagcttggctgcaggt (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameZapA
-
SpeciesE. coli
-
Insert Size (bp)327
-
GenBank IDNC_000913.3
- Promoter T5-lac
-
Tag
/ Fusion Protein
- Dronpa (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctttcgtcttcacctcgagaaatc
- 3′ sequencing primer CTTTAATCACCGCGTCATTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJB089 was a gift from Jie Xiao (Addgene plasmid # 98914 ; http://n2t.net/addgene:98914 ; RRID:Addgene_98914) -
For your References section:
A multi-layered protein network stabilizes the Escherichia coli FtsZ-ring and modulates constriction dynamics. Buss J, Coltharp C, Shtengel G, Yang X, Hess H, Xiao J. PLoS Genet. 2015 Apr 7;11(4):e1005128. doi: 10.1371/journal.pgen.1005128. eCollection 2015 Apr. PGENETICS-D-14-03238 [pii] PubMed 25848771