Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV2_hSyn_iChloC_CA_Citrine
(Plasmid #98220)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98220 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV2
  • Backbone size w/o insert (bp) 5303
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Synthetic construct iChloC_C128A gene
  • Alt name
    iChloC
  • Alt name
    CrChR2
  • Species
    Synthetic; Chlamydomonas reinhardtii
  • Insert Size (bp)
    927
  • Mutation
    E83Q, E90R, E101S, C128A, T159C, D156N
  • Promoter human synapsin
  • Tag / Fusion Protein
    • Citrine (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer TGAACAGCTCCTCGCCCTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2017/06/27/156422 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV2_hSyn_iChloC_CA_Citrine was a gift from Simon Wiegert (Addgene plasmid # 98220 ; http://n2t.net/addgene:98220 ; RRID:Addgene_98220)
  • For your References section:

    Anion-conducting channelrhodopsins with tuned spectra and modified kinetics engineered for optogenetic manipulation of behavior. Wietek J, Rodriguez-Rozada S, Tutas J, Tenedini F, Grimm C, Oertner TG, Soba P, Hegemann P, Wiegert JS. Sci Rep. 2017 Nov 2;7(1):14957. doi: 10.1038/s41598-017-14330-y. 10.1038/s41598-017-14330-y [pii] PubMed 29097684