-
PurposeAmplified expression of GCaMP6f in combination with TET driver
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 97410 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4477
- Total vector size (bp) 5830
-
Modifications to backboneTRE3 promoter, WPRE
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP6f
-
SpeciesR. norvegicus (rat), G. gallus (chicken); Aequorea coerulescens
-
Insert Size (bp)1353
- Promoter TRE3
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTGAACTTGTGGCCGTTTAC
- 3′ sequencing primer ccttgtataaatcctggttgctg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAVTREGCaMP6f was a gift from Tetsuo Yamamori (Addgene plasmid # 97410 ; http://n2t.net/addgene:97410 ; RRID:Addgene_97410) -
For your References section:
Long-Term Two-Photon Calcium Imaging of Neuronal Populations with Subcellular Resolution in Adult Non-human Primates. Sadakane O, Masamizu Y, Watakabe A, Terada S, Ohtsuka M, Takaji M, Mizukami H, Ozawa K, Kawasaki H, Matsuzaki M, Yamamori T. Cell Rep. 2015 Dec 1;13(9):1989-99. doi: 10.1016/j.celrep.2015.10.050. Epub 2015 Nov 19. 10.1016/j.celrep.2015.10.050 PubMed 26655910