Skip to main content

pAAV-TRE-GCaMP6s
(Plasmid #135418)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135418 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAVTREGCaMP6f
  • Backbone manufacturer
    Tetsuo Yamamori
  • Backbone size w/o insert (bp) 5830
  • Total vector size (bp) 5765
  • Modifications to backbone
    A fragment containing GCaMP6s was swapped into replace GCaMP6f in the original backbone.
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6s
  • Alt name
    GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
  • Alt name
    GCaMP3 variant 641
  • Species
    R. norvegicus (rat); A. victoria (jellyfish)
  • Insert Size (bp)
    1274
  • Promoter TRE

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NHEI (not destroyed)
  • 5′ sequencing primer TAGCGCCACCATGGTCGACTCA
  • 3′ sequencing primer GGATCCTTACTACTTCGCT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GCaMP6s was synthesized de novo based on sequences published by Douglas Kim et al, Janelia Research Campus in Chen et al, 2013 PMID: 23868258.

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-TRE-GCaMP6s was a gift from Rylan Larsen (Addgene plasmid # 135418 ; http://n2t.net/addgene:135418 ; RRID:Addgene_135418)