Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCOTS-pyl-GFP(35TAG)
(Plasmid #92047)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92047 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCB4
  • Backbone size w/o insert (bp) 7500
  • Total vector size (bp) 14807
  • Modifications to backbone
    In addition to E. coli origin, we have introduced the 2micron yeast origin and URA3 marker to enable genetic engineering using yeast assembly.
  • Vector type
    Replicative expression plasmid for cyanobacteria S. elongatus (PCC7942).
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    There is also spect and URA3 markers encoded in this vector.
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    EGFP
  • Insert Size (bp)
    720
  • Mutation
    Tyrosine in position 35 of the GFP was mutated from TAC to TAG to facilitate incorporation of unnatural amino acid
  • Promoter PpsbII
  • Tag / Fusion Protein
    • Histag (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCTTGGGCGATCGCTCTAAAC
  • 3′ sequencing primer GCAAAATTAGCTGAGGGCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Pyrrolysyl tRNA(cua)
  • Alt name
    Pyl-tRNA
  • Species
    Methanosarcina mazei
  • Insert Size (bp)
    72
  • Promoter LeuP (native S. elongatus promoter)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTATTAGGCAAATGCCAGTTAC
  • 3′ sequencing primer GTAAACCGCGAAGGTCGTGAAGG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Pyrrolysyl tRNA synthetase (methanosarcina mazei)
  • Alt name
    PylRS
  • Species
    Methanosarcina mazei
  • Insert Size (bp)
    1365
  • Promoter PrcbL

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCACACCACGTAATTTG
  • 3′ sequencing primer CACAGGAAACAGCTATGACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCOTS-pyl-GFP(35TAG) was a gift from Lital Alfonta (Addgene plasmid # 92047 ; http://n2t.net/addgene:92047 ; RRID:Addgene_92047)
  • For your References section:

    Expanding the Genetic Code of a Photoautotrophic Organism. Chemla Y, Friedman M, Heltberg M, Bakhrat A, Nagar E, Schwarz R, Jensen MH, Alfonta L. Biochemistry. 2017 Apr 12. doi: 10.1021/acs.biochem.7b00131. 10.1021/acs.biochem.7b00131 PubMed 28394580