pCOTS-pyl-GFP(35TAG)
(Plasmid #92047)

• Purpose: This is a S. elongatus (PCC7942) cyanobacterial plasmid that encodes the pylRS orthogonal translation system. In addition it encodes for a GFP reporter with TAG mutation at site 35.
• Depositing Lab: Lital Alfonta
• Publication: Chemla et al Biochemistry. 2017 Apr 12. doi: 10.1021/acs.biochem.7b00131.

Backbone

• Vector backbone: pCB4
• Backbone size w/o insert (bp): 7500
• Total vector size (bp): 14807
• Modifications to backbone: In addition to E. coli origin, we have introduced the 2micron yeast origin and URA3 marker to enable genetic engineering using yeast assembly.
• Vector type: Replicative expression plasmid for cyanobacteria S. elongatus (PCC7942).
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: There is also spect and URA3 markers encoded in this vector.
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: EGFP
• Insert Size (bp): 720
• Mutation: Tyrosine in position 35 of the GFP was mutated from TAC to TAG to facilitate incorporation of unnatural amino acid
• Promoter: PpsbII
• Tag / Fusion Protein:
  • Histag (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCTTGGGCGATCGCTCTAAAC
• 3′ sequencing primer: GCAAAATTAGCTGAGGGCG

Gene/Insert 2

• Gene/Insert name: Pyrrolysyl tRNA(cua)
• Alt name: Pyl-tRNA
• Species: Methanosarcina mazei
• Insert Size (bp): 72
• Promoter: LeuP (native S. elongatus promoter)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTATTAGGCAAATGCCAGTTAC
• 3′ sequencing primer: GTAAACCGCGAAGGTCGTGAAGG

Gene/Insert 3

• Gene/Insert name: Pyrrolysyl tRNA synthetase (methanosarcina mazei)
• Alt name: PylRS
• Species: Methanosarcina mazei
• Insert Size (bp): 1365
• Promoter: PrcbL

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCACACCACGTAATTTG
• 3′ sequencing primer: CACAGGAAACAGCTATGACC

Resource Information

• Supplemental Documents:
  • pCOTS-pyl-GFP(35TAG) (PpsbII).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry