Skip to main content
Addgene

pACYC_HA-ZmSAE1_ZmSAE2-FLAG
(Plasmid #91944)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91944 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pACYCDuet-1
  • Backbone size w/o insert (bp) 4008
  • Total vector size (bp) 6984
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    HA-ZmSAE1
  • Species
    Zea mays
  • Insert Size (bp)
    1035
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer GGATCTCGACGCTCTCCCT
  • 3′ sequencing primer GATTATGCGGCCGTGTACAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ZmSAE2-FLAG
  • Species
    Zea mays
  • Insert Size (bp)
    1941
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer TGTACACGGCCGCATAATC
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACYC_HA-ZmSAE1_ZmSAE2-FLAG was a gift from Richard Vierstra (Addgene plasmid # 91944 ; http://n2t.net/addgene:91944 ; RRID:Addgene_91944)
  • For your References section:

    Defining the SUMO System in Maize: SUMOylation Is Up-Regulated during Endosperm Development and Rapidly Induced by Stress. Augustine RC, York SL, Rytz TC, Vierstra RD. Plant Physiol. 2016 Jul;171(3):2191-210. doi: 10.1104/pp.16.00353. Epub 2016 May 15. 10.1104/pp.16.00353 PubMed 27208252