Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRSF_6His-ZmSUMO1a-GG_ZmSCE1b-Myc
(Plasmid #91932)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 91932 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRSFDuet-1
  • Backbone size w/o insert (bp) 3829
  • Total vector size (bp) 4625
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    6His-ZmSUMO1a-GG
  • Species
    Zea mays
  • Insert Size (bp)
    283
  • Mutation
    Truncation of ZmSUMO1a after the diGlycine motif
  • Tag / Fusion Protein
    • 6His (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer GGATCTCGACGCTCTCCCT
  • 3′ sequencing primer GATTATGCGGCCGTGTACAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ZmSCE1b-Myc
  • Species
    Zea mays
  • Insert Size (bp)
    513
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer TGTACACGGCCGCATAATC
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSF_6His-ZmSUMO1a-GG_ZmSCE1b-Myc was a gift from Richard Vierstra (Addgene plasmid # 91932 ; http://n2t.net/addgene:91932 ; RRID:Addgene_91932)
  • For your References section:

    Defining the SUMO System in Maize: SUMOylation Is Up-Regulated during Endosperm Development and Rapidly Induced by Stress. Augustine RC, York SL, Rytz TC, Vierstra RD. Plant Physiol. 2016 Jul;171(3):2191-210. doi: 10.1104/pp.16.00353. Epub 2016 May 15. 10.1104/pp.16.00353 PubMed 27208252