pACYC_HA-ZmSAE1
(Plasmid
#91942)
-
PurposeBacterial expression of maize SAE1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 91942 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepACYCDuet-1
- Backbone size w/o insert (bp) 4008
- Total vector size (bp) 5043
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHA-ZmSAE1
-
SpeciesZea mays
-
Insert Size (bp)1035
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer GGATCTCGACGCTCTCCCT
- 3′ sequencing primer GATTATGCGGCCGTGTACAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACYC_HA-ZmSAE1 was a gift from Richard Vierstra (Addgene plasmid # 91942 ; http://n2t.net/addgene:91942 ; RRID:Addgene_91942) -
For your References section:
Defining the SUMO System in Maize: SUMOylation Is Up-Regulated during Endosperm Development and Rapidly Induced by Stress. Augustine RC, York SL, Rytz TC, Vierstra RD. Plant Physiol. 2016 Jul;171(3):2191-210. doi: 10.1104/pp.16.00353. Epub 2016 May 15. 10.1104/pp.16.00353 PubMed 27208252