LP380
(Plasmid #90206)

• Purpose: pEGFP-C1 with cDNA encoding HsDLEC1 full length
• Depositing Lab: Lotte Pedersen
• Publication: Verdier et al Methods Mol Biol. 2016;1454:15-33. doi: 10.1007/978-1-4939-3789-9_2.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 9965
• Modifications to backbone: None
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: DLEC1
• Species: H. sapiens (human)
• Insert Size (bp): 5265
• Mutation: full length protein, no mutations
• GenBank ID: AAI71799.1
• Entrez Gene: DLEC1 (a.k.a. CFAP81, DLC-1, DLC1, F56, FAP81)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: EGFP-C: CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: SV40pA-R: GAAATTTGTGATGCTATTGC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry