GFP-hCCDC11
(Plasmid
#122871)
-
PurposeLabels centriolar satellites in mammalian cells
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122871 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCS2+
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman CCDC11
-
Alt nameCFAP53
-
SpeciesH. sapiens (human)
-
Entrez GeneCFAP53 (a.k.a. CCDC11, HTX6)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer AATACGACTCACTATAG
- 3′ sequencing primer M13R (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A human CCDC11 cDNA, kindly provided by Dr. Moe Mahjoub at Washington University, was subcloned into the V8 BB.GFPLT CS2+ vector (Addgene plasmid #17099).
The insert can be sequenced using the following primers: forward (GFP primer), ACCACATGGTCCTTCTTCAG;
reverse (T7 primer), TTATGCTGAGTGATATC.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-hCCDC11 was a gift from FENG-QIAN Li & Ken-Ichi Takemaru (Addgene plasmid # 122871 ; http://n2t.net/addgene:122871 ; RRID:Addgene_122871)