LP538
(Plasmid #90202)

• Purpose: pCMV-myc with cDNA encoding HsTRAPPC8 full length
• Depositing Lab: Lotte Pedersen
• Publication: Verdier et al Methods Mol Biol. 2016;1454:15-33. doi: 10.1007/978-1-4939-3789-9_2.

Backbone

• Vector backbone: pCMV-Myc
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3800
• Total vector size (bp): 8105
• Modifications to backbone: None
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TRAPPC8
• Species: H. sapiens (human)
• Insert Size (bp): 4305
• Mutation: full length protein, no mutations
• GenBank ID: BAG10409.1
• Entrez Gene: TRAPPC8 (a.k.a. GSG1, HsT2706, KIAA1012, TRS85)
• Promoter: CMV
• Tag / Fusion Protein:
  • Myc (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CMV-F: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: M13 Reverse: CAGGAAACAGCTATGAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Figures in Verdier et al. 2016 might suggest Myc tag is at the C-terminus, but the cloning vector is pCMV-Myc and the Myc tag is placed on N-terminus of protein