Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

LP555
(Plasmid #90204)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 90204 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV-Myc
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 6005
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TRAPPC8
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2205
  • Mutation
    aa residues 701-1436
  • GenBank ID
    BAG10409.1
  • Entrez Gene
    TRAPPC8 (a.k.a. GSG1, HsT2706, KIAA1012, TRS85)
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CMV-F: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer M13 Reverse: CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Figures in Verdier et al. 2016 might suggest Myc tag is at the C-terminus, but the cloning vector is pCMV-Myc and the Myc tag is placed on N-terminus of protein

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LP555 was a gift from Lotte Pedersen (Addgene plasmid # 90204 ; http://n2t.net/addgene:90204 ; RRID:Addgene_90204)
  • For your References section:

    Targeting of ASH Domain-Containing Proteins to the Centrosome. Verdier P, Morthorst SK, Pedersen LB. Methods Mol Biol. 2016;1454:15-33. doi: 10.1007/978-1-4939-3789-9_2. 10.1007/978-1-4939-3789-9_2 PubMed 27514913