NGN3-T2A-NLS-tdTomato-ires-puro-BGHpA-PGK-puro
(Plasmid #89994)

• Purpose: Donor template for generation of NGN3-ntdTomato reporter cell lines
• Depositing Lab: Timo Otonkoski
• Publication: Otonkoski lab Reporter cell lines plasmids (unpublished)

Backbone

• Vector backbone: pUC19
• Total vector size (bp): 9769
• Vector type: CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NGN3-T2A-NLS-TdTomato-ires-puro-BGHpA-PGK-puro
• Species: H. sapiens (human)
• Entrez Gene: NEUROG3 (a.k.a. Atoh5, Math4B, NGN-3, bHLHa7, ngn3)
• Promoter: none

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: M13-rv caggaaacagctatgaccatg
• 3′ sequencing primer: M13-fwd tgtaaaacgacggccagt

Resource Information

• Supplemental Documents:
  • Ngn3-T2A-NLS-TdTomato-ires-puro-BGHpA-PGK-puro.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: tdTomato sequence was cloned from pCSCMV:tdTomato (a gift from Gerhart Ryffel, Addgene plasmid #30530)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry