-
PurposeTargeting construct for intergrating a doxycycline (DOX) inducible SAM CRISPR activation complex -2A-GFP to the AAVS1 locus.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176836 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAVS1
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-VP64-2A-MS2-p65-HSF1-2A-GFP
-
SpeciesH. sapiens (human), Synthetic
-
MutationSee Depositor Comments Below
- Promoter Tet operator (tetracycline inducible expression)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer gtaccacttcctaccctcgtaaac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains K140R, I414T, and K1097R mutations in Cas9. These mutations are not known to affect plasmid function.
Please visit https://www.biorxiv.org/content/10.1101/2022.03.24.485641v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DOX_SAM_CRISPR-activation-2A-GFP-AAVS1-targeting-construct was a gift from Rudolf Jaenisch (Addgene plasmid # 176836 ; http://n2t.net/addgene:176836 ; RRID:Addgene_176836) -
For your References section:
The nuclear receptor THRB facilitates differentiation of human PSCs into more mature hepatocytes. Ma H, de Zwaan E, Guo YE, Cejas P, Thiru P, van de Bunt M, Jeppesen JF, Syamala S, Dall'Agnese A, Abraham BJ, Fu D, Garrett-Engele C, Lee TI, Long HW, Griffith LG, Young RA, Jaenisch R. Cell Stem Cell. 2022 Apr 13. pii: S1934-5909(22)00150-3. doi: 10.1016/j.stem.2022.03.015. 10.1016/j.stem.2022.03.015 PubMed 35452598