pcDNA3-myc-FLNa S2152A
(Plasmid #8983)

• Depositing Lab: John Blenis
• Publication: Woo et al Mol Cell Biol. 2004 Apr . 24(7):3025-35.

Backbone

• Vector backbone: pcDNA3
• Backbone size w/o insert (bp): 5446
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Filamin A S2152A
• Alt name: Filamin A
• Alt name: FLNa
• Species: H. sapiens (human)
• Insert Size (bp): 8640
• Mutation: Ser2152Ala
• Entrez Gene: FLNA (a.k.a. ABP-280, ABPX, CSBS, CVD1, FGS2, FLN, FLN-A, FLN1, FMD, MNS, NHBP, OPD, OPD1, OPD2, XLVD, XMVD)
• Tag / Fusion Protein:
  • myc (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: T7
• 3′ sequencing primer: SP6

Resource Information

• Articles Citing this Plasmid:
  • 11 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

S2152A mutation made using Stratgene Quikchange mutagenesis kit. 5' FLNa-Ala2152 primer (GCAGGCGTCGGGCTCCTGCAGTGGCCAACGTTG) and 3' FLNa-Ala2152 primer (CAACGTTGGCCACTGCAGGAGCCCGACGCCTGC). See author's map for details of wild-type version of this plasmid.