T7-AglC-His6
(Plasmid
#89726)
-
PurposeExpresses AglC from M. voltae with an N-terminal T7 tag and a C-terminal His6 tag. Plasmid has codons optimized for E. coli expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89726 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET24a(+)
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5310
- Total vector size (bp) 6276
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAglC
-
SpeciesMethanococcus voltae
-
Insert Size (bp)966
-
GenBank IDEU726231.1
-
Tags
/ Fusion Proteins
- T7 (N terminal on backbone)
- His6 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer ATGAATTTTATTTCAATAATAATTCCTACGTTCAATGAAGAAAA
- 3′ sequencing primer TTATTTAAAAGTTGAATTTCCTTTTATTAATCCTTTAAAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T7-AglC-His6 was a gift from Barbara Imperiali (Addgene plasmid # 89726 ; http://n2t.net/addgene:89726 ; RRID:Addgene_89726) -
For your References section:
Chemoenzymatic Synthesis and Applications of Prokaryote-Specific UDP-Sugars. Zamora CY, Schocker NS, Chang MM, Imperiali B. Methods Enzymol. 2017;597:145-186. doi: 10.1016/bs.mie.2017.06.003. Epub 2017 Jul 5. 10.1016/bs.mie.2017.06.003 PubMed 28935101