pJK-caCas9-NatMX-Neut5L-Ade2 drive
(Plasmid
#89577)
-
PurposecaCas9 integrating vector into the Neut5L locus with gene drive for targeting Ade2 locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJK1027
- Backbone size w/o insert (bp) 7000
-
Modifications to backboneInserted caCas9 and Neut5L homology arms
-
Vector typeYeast Expression, Synthetic Biology
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAde2 gene drive
-
SpeciesC. albicans
-
Insert Size (bp)1000
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGCAATTATTAGAGATCCAGAAAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Ade2 targeting gene drive, dual guide vector system.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJK-caCas9-NatMX-Neut5L-Ade2 drive was a gift from George Church (Addgene plasmid # 89577 ; http://n2t.net/addgene:89577 ; RRID:Addgene_89577) -
For your References section:
A CRISPR-Cas9-based gene drive platform for genetic interaction analysis in Candida albicans. Shapiro RS, Chavez A, Porter CBM, Hamblin M, Kaas CS, DiCarlo JE, Zeng G, Xu X, Revtovich AV, Kirienko NV, Wang Y, Church GM, Collins JJ. Nat Microbiol. 2018 Jan;3(1):73-82. doi: 10.1038/s41564-017-0043-0. Epub 2017 Oct 23. 10.1038/s41564-017-0043-0 PubMed 29062088