Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

DNA-CARtcr-IRESpuro
(Plasmid #89346)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89346 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHR
  • Total vector size (bp) 11654
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TCR beta gene (Jurkat allele) fused at the N terminus to the SNAP tag
  • Species
    H. sapiens (human)
  • Promoter SFFV
  • Tag / Fusion Protein
    • SNAPf tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Mlu1 (not destroyed)
  • 3′ cloning site BamH1 (unknown if destroyed)
  • 5′ sequencing primer SFFV for (GCTTCCCGAGCTCTATAAAAGAGC)
  • 3′ sequencing primer IRES rev, WPRE rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DNA-CARtcr-IRESpuro was a gift from Ron Vale (Addgene plasmid # 89346 ; http://n2t.net/addgene:89346 ; RRID:Addgene_89346)
  • For your References section:

    A DNA-Based T Cell Receptor Reveals a Role for Receptor Clustering in Ligand Discrimination. Taylor MJ, Husain K, Gartner ZJ, Mayor S, Vale RD. Cell. 2017 Mar 23;169(1):108-119.e20. doi: 10.1016/j.cell.2017.03.006. 10.1016/j.cell.2017.03.006 PubMed 28340336