-
Purposelenti vector encoding the MS2-P65-HSF1 activator helper complex with a 2A Hygro resistance marker (EF1a-MS2-p65-HSF1-2A-Hygro-WPRE). This version has a higher virus titer.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89308 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneplenti
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMS2-P65-HSF1_2A_Hygro
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2526
-
MutationN55K in MS2
-
Entrez GeneRELA (a.k.a. AIF3BL3, CMCU, NFKB3, p65)
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BsiWI (not destroyed)
- 5′ sequencing primer cacatagcgtaaaaggagcaacatag
- 3′ sequencing primer GTTTGGATCTTGGTTCATTCTCAAGCCTCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiMPH v2 was a gift from Feng Zhang (Addgene plasmid # 89308 ; http://n2t.net/addgene:89308 ; RRID:Addgene_89308) -
For your References section:
Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening. Joung J, Konermann S, Gootenberg JS, Abudayyeh OO, Platt RJ, Brigham MD, Sanjana NE, Zhang F. Nat Protoc. 2017 Apr;12(4):828-863. doi: 10.1038/nprot.2017.016. Epub 2017 Mar 23. 10.1038/nprot.2017.016 PubMed 28333914