Skip to main content
Addgene

lenti sgRNA(MS2)_puro optimized backbone
(Plasmid #73797)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73797 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Cloning Grade DNA 73797-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $105

Backbone

  • Vector backbone
    pLKO
  • Backbone size (bp) 8162
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Promoter U6 and EF1A
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GAG GGC CTA TTT CCC ATG ATT CCT TCA TAT
  • 3′ sequencing primer cctagaaggtccattagctgcaaagattcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Information for Cloning Grade DNA (Catalog # 73797-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $105 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti sgRNA(MS2)_puro optimized backbone was a gift from Feng Zhang (Addgene plasmid # 73797 ; http://n2t.net/addgene:73797 ; RRID:Addgene_73797)
  • For your References section:

    Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening. Joung J, Konermann S, Gootenberg JS, Abudayyeh OO, Platt RJ, Brigham MD, Sanjana NE, Zhang F. Nat Protoc. 2017 Apr;12(4):828-863. doi: 10.1038/nprot.2017.016. Epub 2017 Mar 23. 10.1038/nprot.2017.016 PubMed 28333914