1183_pAAV-U6-Ex14-gRNAd-CB-EmGFP
(Plasmid
#89061)
-
PurposeAAV-gRNA targeting the murine Ldlr gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89061 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEMBL8
- Backbone size w/o insert (bp) 2508
- Total vector size (bp) 4596
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsConfirm ITR's remain intact with XmaI, SnaBI, PvuII digests
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEmGFP
-
gRNA/shRNA sequenceTGCTGCTGGCCAAGGACATG
-
SpeciesAequorea Victoria
- Promoter Chicken beta actin with partial CMV enhancer
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CCTTCATATTTGCATATACGATACAAGGCTGTTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1183_pAAV-U6-Ex14-gRNAd-CB-EmGFP was a gift from William Lagor (Addgene plasmid # 89061 ; http://n2t.net/addgene:89061 ; RRID:Addgene_89061) -
For your References section:
Somatic genome editing with CRISPR/Cas9 generates and corrects a metabolic disease. Jarrett KE, Lee CM, Yeh YH, Hsu RH, Gupta R, Zhang M, Rodriguez PJ, Lee CS, Gillard BK, Bissig KD, Pownall HJ, Martin JF, Bao G, Lagor WR. Sci Rep. 2017 Mar 16;7:44624. doi: 10.1038/srep44624. 10.1038/srep44624 PubMed 28300165