mLama1 AAV sgRNA 1, 2, 5
(Plasmid
#135339)
-
PurposeExpression plasmid of VP64-SadCas9 sgRNA 1, 2 and 3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135339 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX601
-
Backbone manufacturerAddgene (61591)
- Backbone size w/o insert (bp) 3494
- Total vector size (bp) 5600
-
Modifications to backboneNone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLama1 VP64-dCas9 sgRNA Guides
-
gRNA/shRNA sequenceLaminin Alpha 1
-
SpeciesM. musculus (mouse)
-
GenBank ID16773 16773
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer TCTAGTTGCCAGCCATCTGTTG
- 3′ sequencing primer GGCGCGTACTATGGTTGCTTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byN/A
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mLama1 AAV sgRNA 1, 2, 5 was a gift from Ronald Cohn (Addgene plasmid # 135339 ; http://n2t.net/addgene:135339 ; RRID:Addgene_135339) -
For your References section:
A mutation-independent approach for muscular dystrophy via upregulation of a modifier gene. Kemaladewi DU, Bassi PS, Erwood S, Al-Basha D, Gawlik KI, Lindsay K, Hyatt E, Kember R, Place KM, Marks RM, Durbeej M, Prescott SA, Ivakine EA, Cohn RD. Nature. 2019 Aug;572(7767):125-130. doi: 10.1038/s41586-019-1430-x. Epub 2019 Jul 24. 10.1038/s41586-019-1430-x PubMed 31341277