-
Purpose3xFLAG 2xVP64 SadCas9 for single guide cloning
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135338 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX601
-
Backbone manufacturerAddgene (61591)
- Backbone size w/o insert (bp) 4010
- Total vector size (bp) 7667
-
Modifications to backboneNone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSadCas9
-
Alt namedSauCas9
-
Alt namedSaCas9
-
SpeciesStaphylococcus aureus
-
Insert Size (bp)3405
-
MutationD10A and N580A
- Promoter CMV
-
Tags
/ Fusion Proteins
- 3xFLAG-VP64-SV40 NLS (N terminal on insert)
- NLS-VP64 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGCACCAAAATCAACGGGACTTTC
- 3′ sequencing primer CTTTCAAGTTACGGTAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byN/A
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
3XFLAG-VP64-SadCas9-NLS-VP64 was a gift from Ronald Cohn (Addgene plasmid # 135338 ; http://n2t.net/addgene:135338 ; RRID:Addgene_135338) -
For your References section:
A mutation-independent approach for muscular dystrophy via upregulation of a modifier gene. Kemaladewi DU, Bassi PS, Erwood S, Al-Basha D, Gawlik KI, Lindsay K, Hyatt E, Kember R, Place KM, Marks RM, Durbeej M, Prescott SA, Ivakine EA, Cohn RD. Nature. 2019 Aug;572(7767):125-130. doi: 10.1038/s41586-019-1430-x. Epub 2019 Jul 24. 10.1038/s41586-019-1430-x PubMed 31341277