-
PurposeattB FlpStop plasmid, for insertion into MiMIC site
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 88910 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepBS-KS-attB1-2
-
Backbone manufacturerGene Disruption Project, see Venken et al., 2011, Nat. Methods 8(9): 737-743
- Backbone size w/o insert (bp) 4752
- Total vector size (bp) 7630
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFlpStop
-
SpeciesSynthetic
-
Insert Size (bp)2878
- Promoter 5XUAS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGAACTTCTCTTTGCACCATTT
- 3′ sequencing primer CCCAGGCTTTACACTTTATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFlpStop-attB-UAS-2.1-tdTom was a gift from Tom Clandinin (Addgene plasmid # 88910 ; http://n2t.net/addgene:88910 ; RRID:Addgene_88910) -
For your References section:
FlpStop, a tool for conditional gene control in Drosophila. Fisher YE, Yang HH, Isaacman-Beck J, Xie M, Gohl DM, Clandinin TR. Elife. 2017 Feb 17;6. pii: e22279. doi: 10.7554/eLife.22279. 10.7554/eLife.22279 PubMed 28211790
Map uploaded by the depositor.
