-
PurposeDrosophila, Splicing acceptor, STOP, dsRED, RFP, SV40 terminator, flanked attP. section marker, assemble with homology arms to make Donor plasmid for CRISPR.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60944 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJET1.2
-
Backbone manufacturerThermo Scientific
- Backbone size w/o insert (bp) 2974
- Total vector size (bp) 4785
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedsRED
-
Alt nameRFP
- Promoter 3XP3
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cgactcactatagggagagcggc
- 3′ sequencing primer aagaacatcgattttccatggcag (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid contains an IS4-like element that does not interfere with function as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJET1.2-STOP-dsRed was a gift from Frank Schnorrer (Addgene plasmid # 60944 ; http://n2t.net/addgene:60944 ; RRID:Addgene_60944) -
For your References section:
A Versatile Two-Step CRISPR- and RMCE-Based Strategy for Efficient Genome Engineering in Drosophila. Zhang X, Koolhaas WH, Schnorrer F. G3 (Bethesda). 2014 Oct 15. pii: g3.114.013979. doi: 10.1534/g3.114.013979. 10.1534/g3.114.013979 PubMed 25324299