pSCALPs-HA-NFAT1 (4-460)-GFP
(Plasmid #88879)

• Purpose: Lentiviral vector expressing the fusion protein HA-NFAT1 (4-460)-GFP
• Depositing Lab: Silvia Monticelli
• Publication: Leoni et al Proc Natl Acad Sci U S A. 2017 Feb 6. pii: 201616420. doi: 10.1073/pnas.1616420114.

Backbone

• Vector backbone: pSCALPs
• Backbone size w/o insert (bp): 7740
• Total vector size (bp): 9951
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HA-NFAT1 (4-460)-GFP fusion protein
• Species: M. musculus (mouse)
• Insert Size (bp): 2271
• Mutation: amino acids 4-460 only; L78P & L287P *see below
• Entrez Gene: Nfatc2 (a.k.a. AI607462, NF-ATc2, NF-ATp, NFAT1, NFAT1-D, Nfatp)
• Promoter: SFFV (spleen focus forming virus)
• Tags / Fusion Proteins:
  • HA tag (N terminal on insert)
  • GFP fusion protein (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: HpaI (not destroyed)
• 5′ sequencing primer: GCTTCTCGCTTCTGTTCG
• 3′ sequencing primer: GTTGTCAAGCGATGAGGCGCGT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The insert was subcloned starting from Addgene plasmid #11107. DEPOSITING LAB: Anjana Rao PUBLICATION: Aramburu et al Science. 1999 Sep 24. 285(5436):2129-33.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

*Note: The insert in this construct contains two amino acid residue substitutions (L78P and L287P) carried over from the parental vector HA-NFAT1(4-460)-GFP (Addgene plasmid #11107). These residue changes do not alter the ability of the protein to translocate into the nucleus in response to stimuli, and the plasmid functions as described in the associated publication.