Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSCALPs-HA-NFAT1 (4-460)-GFP
(Plasmid #88879)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 88879 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSCALPs
  • Backbone size w/o insert (bp) 7740
  • Total vector size (bp) 9951
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HA-NFAT1 (4-460)-GFP fusion protein
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2271
  • Mutation
    amino acids 4-460 only; L78P & L287P *see below
  • Entrez Gene
    Nfatc2 (a.k.a. AI607462, NF-ATc2, NF-ATp, NFAT1, NFAT1-D, Nfatp)
  • Promoter SFFV (spleen focus forming virus)
  • Tags / Fusion Proteins
    • HA tag (N terminal on insert)
    • GFP fusion protein (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer GCTTCTCGCTTCTGTTCG
  • 3′ sequencing primer GTTGTCAAGCGATGAGGCGCGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The insert was subcloned starting from Addgene plasmid #11107. DEPOSITING LAB: Anjana Rao PUBLICATION: Aramburu et al Science. 1999 Sep 24. 285(5436):2129-33.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

*Note: The insert in this construct contains two amino acid residue substitutions (L78P and L287P) carried over from the parental vector HA-NFAT1(4-460)-GFP (Addgene plasmid #11107). These residue changes do not alter the ability of the protein to translocate into the nucleus in response to stimuli, and the plasmid functions as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSCALPs-HA-NFAT1 (4-460)-GFP was a gift from Silvia Monticelli (Addgene plasmid # 88879 ; http://n2t.net/addgene:88879 ; RRID:Addgene_88879)
  • For your References section:

    Dnmt3a restrains mast cell inflammatory responses. Leoni C, Montagner S, Rinaldi A, Bertoni F, Polletti S, Balestrieri C, Monticelli S. Proc Natl Acad Sci U S A. 2017 Feb 6. pii: 201616420. doi: 10.1073/pnas.1616420114. 10.1073/pnas.1616420114 PubMed 28167789