pCA24N-ligase-NLS-cTF
(Plasmid #87746)

• Purpose: IPTG-inducible expression of ligase-NLS-cTF fusion for protein purification
• Depositing Lab: Wayne Patrick
• Publication: Wilson et al Protein Eng Des Sel. 2013 Jul;26(7):471-8. doi: 10.1093/protein/gzt024. Epub 2013 Jun 10.

Backbone

• Vector backbone: pCA24N
• Backbone manufacturer: Kitagawa et al. (PMID:16769691)
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: T4 DNA ligase
• Entrez Gene: 30 (a.k.a. T4p202, lig)
• Promoter: T5-lac
• Tags / Fusion Proteins:
  • 6xHis (N terminal on backbone)
  • NLS linker - cTF (chimeric transcription factor based on NFAT/NF-kB) (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: pCA24N.for (GATAACAATTTCACACAGAATTCATTAAAGAG)
• 3′ sequencing primer: pCA24N.rev2 — 5'-CAAATCCAGATGGAGTTCTGAGG-3'

Resource Information

• Supplemental Documents:
  • pCA24N-Ligase-NLS-cTF.gb
• A portion of this plasmid was derived from a plasmid made by: Previously, we PCR amplified the lig gene from pRBL (Ren et al., 1997; PMID: 9305776). The cTF gene was amplified from pSAN101 (de Lumley et al., 2004; PMID: 15178248).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For complete cloning information, please see the paper's supplement.
For expression, E. coli DH5a-E cells harbouring each expression vector were grown at 37°C in LB broth containing chloramphenicol (34 µg.ml-1), to OD600 ~ 0.6. IPTG (0.4 mM, final concentration) was added as an inducer, and protein over-expression was at 28°C for 16-18 h.