pEGFP-C1-ADRP
(Plasmid #87161)

• Purpose: Fluorescent protein localized to lipid droplets (LDs)
• Depositing Lab: Elina Ikonen
• Publication: Salo et al EMBO J. 2016 Dec 15;35(24):2699-2716. Epub 2016 Nov 22.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4731
• Total vector size (bp): 6053
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ADRP
• Alt name: PLIN2
• Species: H. sapiens (human)
• Insert Size (bp): 1314
• GenBank ID: BC005127.2
• Entrez Gene: PLIN2 (a.k.a. ADFP, ADRP)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XhoI (destroyed during cloning)
• 5′ sequencing primer: EGFP-C-F catggtcctgctggagttcgtg
• 3′ sequencing primer: EGFP-C-R gttcagggggaggtgtg

Resource Information

• Supplemental Documents:
  • pEGFP-C1-ADRP 296E.gb
• A portion of this plasmid was derived from a plasmid made by: ADRP cDNA from Open Biosystems (Clone ID:3844174)
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This vector was generated by Simon Pfisterer (Elina Ikonen Lab).