pEFIRES-P-mCherry-HPos
(Plasmid #87159)

• Purpose: Fluorescent marker of lipid droplets (LDs)
• Depositing Lab: Elina Ikonen
• Publication: Salo et al EMBO J. 2016 Dec 15;35(24):2699-2716. Epub 2016 Nov 22.

Backbone

• Vector backbone: pEFIRES-P
• Backbone size w/o insert (bp): 5689
• Total vector size (bp): 6571
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HPos
• Species: R. norvegicus (rat), Synthetic; model peptide
• Insert Size (bp): 153
• Promoter: EF-1-alpha
• Tag / Fusion Protein:
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BspEI (not destroyed)
• 3′ cloning site: SmaI (destroyed during cloning)
• 5′ sequencing primer: pEF-forward tctctccacaggtgtccact
• 3′ sequencing primer: pEF-rev acaccggccttattccaagc

Resource Information

• Supplemental Documents:
  • pEFIRES-P-mCherry-HPos 653E.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This vector was generated by Shiqian Li (Elina Ikonen Lab).

HPos model peptide was described by Adam Kassan et al. (J Cell Biol. 2013 Dec 23; 203(6): 985–1001.)

Benefits of using pEFIRES-P vector for stable overexpression in mammalian cells were described by Stephen Hobbs et al. (Biochem Biophys Res Commun. 1998 Nov 18;252(2):368-72.).

pEFIRES-P was a gift from Dr. Olli Ritvos (University of Helsinki).