pEFIRES-P-ACSL3-mCherry
(Plasmid #87158)

• Purpose: Fluorescent protein targeted to lipid droplets (LDs) from the endoplasmic reticulum (ER)
• Depositing Lab: Elina Ikonen
• Publication: Salo et al EMBO J. 2016 Dec 15;35(24):2699-2716. Epub 2016 Nov 22.

Backbone

• Vector backbone: pEFIRES-P
• Backbone size w/o insert (bp): 5689
• Total vector size (bp): 8577
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ACSL3
• Alt name: ACS3
• Species: H. sapiens (human)
• Insert Size (bp): 2160
• GenBank ID: NM_203372.1
• Entrez Gene: ACSL3 (a.k.a. ACS3, FACL3, LACS 3, LACS3, PRO2194)
• Promoter: EF-1-alpha
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: pEF-forward tctctccacaggtgtccact
• 3′ sequencing primer: mCherry-R TTGGTCACCTTCAGCTTGG

Resource Information

• Supplemental Documents:
  • pEFIRES-P-ACSL3-mCherry 640E.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This vector was generated by Shiqian Li (Elina Ikonen Lab).

Benefits of using pEFIRES-P vector for stable overexpression in mammalian cells were described by Stephen Hobbs et al. (Biochem Biophys Res Commun. 1998 Nov 18;252(2):368-72.).

pEFIRES-P was a gift from Dr. Olli Ritvos (University of Helsinki).