pCMV4-ApoE2
(Plasmid #87085)

• Purpose: Expresses ApoE2 in Mammalian cells
• Depositing Lab: Bradley Hyman
• Publication: Hudry et al Sci Transl Med. 2013 Nov 20;5(212):212ra161. doi: 10.1126/scitranslmed.3007000.

Backbone

• Vector backbone: pCMV4
• Backbone size w/o insert (bp): 5066
• Total vector size (bp): 6019
• Vector type: Mammalian Expression
• Selectable markers: unknown

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Apolipoprotein E2
• Alt name: ApoE2
• Species: H. sapiens (human)
• Insert Size (bp): 953
• GenBank ID: NG_007084.2
• Entrez Gene: APOE (a.k.a. AD2, APO-E, ApoE4, LDLCQ5, LPG)
• Promoter: CMV

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CCATTGACGTCAATGGGAGTTTG
• 3′ sequencing primer: GGCACTGGAGTGGCAACTTC

Resource Information

• Supplemental Documents:
  • clone manager of the map
• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note, the ApoE plasmid used in the reference paper was in AAV backbone. The ApoE plasmid deposit here is not in AAV backbone.