-
PurposeExpresses ApoE3 in Mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87086 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV4
- Backbone size w/o insert (bp) 5039
- Total vector size (bp) 5992
-
Vector typeMammalian Expression
-
Selectable markersunknown
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameApolipoprotein E3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)953
-
GenBank IDNG_007084.2
-
Entrez GeneAPOE (a.k.a. AD2, APO-E, ApoE4, LDLCQ5, LPG)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CCATTGACGTCAATGGGAGTTTG
- 3′ sequencing primer GGCACTGGAGTGGCAACTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid used in the reference was in the AAV backbone. The plasmid deposit here is not in AAV backbone.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV4-ApoE3 was a gift from Bradley Hyman (Addgene plasmid # 87086 ; http://n2t.net/addgene:87086 ; RRID:Addgene_87086) -
For your References section:
Gene transfer of human Apoe isoforms results in differential modulation of amyloid deposition and neurotoxicity in mouse brain. Hudry E, Dashkoff J, Roe AD, Takeda S, Koffie RM, Hashimoto T, Scheel M, Spires-Jones T, Arbel-Ornath M, Betensky R, Davidson BL, Hyman BT. Sci Transl Med. 2013 Nov 20;5(212):212ra161. doi: 10.1126/scitranslmed.3007000. 10.1126/scitranslmed.3007000 PubMed 24259049