mCherry-PA(WT)-Vav2
(Plasmid
#86977)
-
PurposePI(DM): Photo-activatable/light sensitive
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86977 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepmCherry
- Backbone size w/o insert (bp) 3969
- Total vector size (bp) 7716
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameLOV2
-
SpeciesSynthetic
-
Insert Size (bp)447
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameVAV2 DH/PH/ZF
-
Alt nameVAV2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1200
-
Entrez GeneVav2 (a.k.a. 2810040F13Rik, AI847175, Vav-2)
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer atggagcagtggcggcaatg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-PA(WT)-Vav2 was a gift from Klaus Hahn (Addgene plasmid # 86977 ; http://n2t.net/addgene:86977 ; RRID:Addgene_86977) -
For your References section:
Engineering extrinsic disorder to control protein activity in living cells. Dagliyan O, Tarnawski M, Chu PH, Shirvanyants D, Schlichting I, Dokholyan NV, Hahn KM. Science. 2016 Dec 16;354(6318):1441-1444. 10.1126/science.aah3404 PubMed 27980211