Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPotef-LN22*-3xGNLS-cbx
(Plasmid #86780)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86780 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC57
  • Total vector size (bp) 7896
  • Vector type
    Bacterial Expression ; Ustilago maydis Expression
  • Selectable markers
    Carboxine

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LN*
  • Alt name
    lambdaN
  • Species
    Phage
  • Insert Size (bp)
    69
  • Promoter Potef
  • Tag / Fusion Protein
    • Gfp (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer TCCAATAAAGGGCGCTGTCTCGGC
  • 3′ sequencing primer TGTGGCCGTTTACGTCGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPotef-LN22*-3xGNLS-cbx was a gift from Michael Feldbrügge (Addgene plasmid # 86780 ; http://n2t.net/addgene:86780 ; RRID:Addgene_86780)
  • For your References section:

    A FYVE zinc finger domain protein specifically links mRNA transport to endosome trafficking. Pohlmann T, Baumann S, Haag C, Albrecht M, Feldbrugge M. Elife. 2015 May 18;4. doi: 10.7554/eLife.06041. 10.7554/eLife.06041 PubMed 25985087