pLVTHM-shRnd3
(Plasmid
#86437)
-
Purpose2nd generation doxycycline-inducible lentiviral vector expressing Rnd3-targeting shRNA and GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86437 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLVTHM
-
Backbone manufacturerDidier Trono Lab (Addgene #12247)
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshRNA targeting RND3
-
gRNA/shRNA sequenceTAGTAGAGCTCTCCAATCACA
-
SpeciesH. sapiens (human)
-
Entrez GeneRND3 (a.k.a. ARHE, Rho8, RhoE, memB)
- Promoter H1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site MluI (unknown if destroyed)
- 5′ sequencing primer H1 (5' tcgctatgtgttctgggaaa 3')
- 3′ sequencing primer SP6 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVTHM-shRnd3 was a gift from Violaine Moreau (Addgene plasmid # 86437 ; http://n2t.net/addgene:86437 ; RRID:Addgene_86437) -
For your References section:
Rnd3/RhoE Is down-regulated in hepatocellular carcinoma and controls cellular invasion. Grise F, Sena S, Bidaud-Meynard A, Baud J, Hiriart JB, Makki K, Dugot-Senant N, Staedel C, Bioulac-Sage P, Zucman-Rossi J, Rosenbaum J, Moreau V. Hepatology. 2012 Jun;55(6):1766-75. doi: 10.1002/hep.25568. 10.1002/hep.25568 PubMed 22234932