Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPonA-BI-Gl NORM-LacZA TER- LacZB
(Plasmid #86212)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86212 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPonA
  • Total vector size (bp) 8020
  • Vector type
    Mammalian Expression ; Ponasterone A inducible promoter

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    beta-Globin
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Mutation
    39TER in beta Globin in MCS II
  • Entrez Gene
    HBB (a.k.a. CD113t-C, ECYT6, beta-globin)
  • Entrez Gene
    Hbb
  • Promoter Ponasterone A inducible
  • Tag / Fusion Protein
    • lacZA or lacZB (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site NheI (unknown if destroyed)
  • 5′ sequencing primer CTCAGACACGAGCTCGGTACC
  • 3′ sequencing primer CGATGCGGCCGCGCTAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPonA-BI-Gl NORM-LacZA TER- LacZB was a gift from Robert Singer (Addgene plasmid # 86212 ; http://n2t.net/addgene:86212 ; RRID:Addgene_86212)
  • For your References section:

    Temporal and spatial characterization of nonsense-mediated mRNA decay. Trcek T, Sato H, Singer RH, Maquat LE. Genes Dev. 2013 Mar 1;27(5):541-51. doi: 10.1101/gad.209635.112. Epub 2013 Feb 21. 10.1101/gad.209635.112 PubMed 23431032