-
PurposeExpresses PP7 coat protein fused to mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61763 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLentiviral vector
- Backbone size w/o insert (bp) 4997
- Total vector size (bp) 7549
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePP7 coat protein fused to mCherry
-
Alt namePP7 coat protein
-
SpeciesPsuedomonas Phage PP7
-
Insert Size (bp)1107
- Promoter Ubc promoter
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CCGGGCCCGCTCTAGATTGAAT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: Addgene's quality control sequencing finds an S136Y amino acid residue substitution in mCherry. The depositing laboratory is confident that the gene product is fully functional and has used it routinely.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PP7_mCherry was a gift from Daniel Larson (Addgene plasmid # 61763 ; http://n2t.net/addgene:61763 ; RRID:Addgene_61763) -
For your References section:
Kinetic competition during the transcription cycle results in stochastic RNA processing. Coulon A, Ferguson ML, de Turris V, Palangat M, Chow CC, Larson DR. Elife. 2014 Oct 1;3. doi: 10.7554/eLife.03939. 10.7554/eLife.03939 PubMed 25271374