pMXs2-MEK1
(Plasmid #86141)

• Purpose: Retroviral vector expressing MEK1-IRES-Bsd-p2A-RFP
• Depositing Lab: David Sabatini
• Publication: Wang et al Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013.

Backbone

• Vector backbone: pMXs2-IRES-Bsd-p2A-RFP
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MEK1
• Species: H. sapiens (human)
• Entrez Gene: MAP2K1 (a.k.a. CFC3, MAPKK1, MEK1, MEL, MKK1, PRKMK1)
• Promoter: LTR

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TACACGCCGCCCACGTGAAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

NOTE: GFP sequence present after the stop codon of the ORF that is not translated. A single nucleotide change at position 542 from G to T was identified resulting in a corresponding amino acid change at position 181 from Arg to Met.