pICH47742:FCP:Cas9YFP
(Plasmid #85986)

• Purpose: Golden Gate Level 1 cassette encoding a Cas9-YFP fusion under the FCP promoter
• Depositing Lab: Thomas Mock
• Publication: Hopes et al Plant Methods. 2016 Nov 24;12:49. doi: 10.1186/s13007-016-0148-0. eCollection 2016.

Backbone

• Vector backbone: pICH47742
• Backbone manufacturer: Sylvestre Marillonnet (Addgene #48001)
• Vector type: CRISPR ; Golden Gate Assembly

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cas9
• Species: Streptococcus pyogenes
• Promoter: FCP
• Tag / Fusion Protein:
  • SV40 NLS, YFP (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: hSpCas9-R1 (CGCTCGTGCTTCTTATCCTC)
• 3′ sequencing primer: EXFP-R

Resource Information

• Supplemental Documents:
  • pICH47742 TPFcp Cas9 YFP.gb
• A portion of this plasmid was derived from a plasmid made by: pTpFCP/NAT described in Poulsen N, Chesley PM, Kröger N. Molecular genetic manipulation of the diatom Thalassiosira pseudonana (Bacillariophyceae), was domesticated by removing BsaI and BpiI sites through site directed mutagenesis. This was then used as a template for the FCP promoter and terminator. A domesticated, S. pyogenes Cas9 with a human codon bias was used.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This construct was assembled using Golden Gate Cloning as described in Hopes et al., 2016.