pKER-mKOk
(Plasmid
#85975)
-
PurposeExpresses mKOk from the EF1a promoter in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85975 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKER
-
Backbone manufacturerCalos Lab
- Total vector size (bp) 4111
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemKOk
-
Insert Size (bp)657
- Promoter EF-1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cgccgttacagatccaagctgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKER-mKOk was a gift from Michele Calos (Addgene plasmid # 85975 ; http://n2t.net/addgene:85975 ; RRID:Addgene_85975) -
For your References section:
In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining. Geisinger JM, Turan S, Hernandez S, Spector LP, Calos MP. Nucleic Acids Res. 2016 Jan 13. pii: gkv1542. 10.1093/nar/gkv1542 PubMed 26762978