Skip to main content
Addgene

Human b2 nicotinic subunit crystallization construct
(Plasmid #85842)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85842 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEZT-BM
  • Backbone manufacturer
    Hibbs Lab
  • Total vector size (bp) 8705
  • Vector type
    Mammalian Expression ; Baculovirus (bacmam) production and mammalian expression
  • Selectable markers
    mEGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human b2 nAChR subunit crystallization construct
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1239
  • Entrez Gene
    CHRNB2 (a.k.a. EFNL3, nAChRB2)
  • Promoter CMV
  • Tag / Fusion Protein
    • C-terminal StrepII tag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ttgcctttctctccacaggt
  • 3′ sequencing primer catgatacaaaggcattaaag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Jon Lindstrom at the University of Pennsylvania

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Human b2 nicotinic subunit crystallization construct was a gift from Ryan Hibbs (Addgene plasmid # 85842 ; http://n2t.net/addgene:85842 ; RRID:Addgene_85842)
  • For your References section:

    X-ray structure of the human alpha4beta2 nicotinic receptor. Morales-Perez CL, Noviello CM, Hibbs RE. Nature. 2016 Oct 3;538(7625):411-415. doi: 10.1038/nature19785. 10.1038/nature19785 PubMed 27698419