Human b2 nicotinic subunit crystallization construct
(Plasmid #85842)

• Purpose: pEZT-BM vector with beta2 gene after CMV promoter, published crystallization construct
• Depositing Lab: Ryan Hibbs
• Publication: Morales-Perez et al Nature. 2016 Oct 3;538(7625):411-415. doi: 10.1038/nature19785.

Backbone

• Vector backbone: pEZT-BM
• Backbone manufacturer: Hibbs Lab
• Total vector size (bp): 8705
• Vector type: Mammalian Expression ; Baculovirus (bacmam) production and mammalian expression
• Selectable markers: mEGFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Human b2 nAChR subunit crystallization construct
• Species: H. sapiens (human)
• Insert Size (bp): 1239
• Entrez Gene: CHRNB2 (a.k.a. EFNL3, nAChRB2)
• Promoter: CMV
• Tag / Fusion Protein:
  • C-terminal StrepII tag

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: ttgcctttctctccacaggt
• 3′ sequencing primer: catgatacaaaggcattaaag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Jon Lindstrom at the University of Pennsylvania

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry