pSH-Csy4-T2A-SpRFN-P2A-GFP-multi-gRNA
(Plasmid #85756)

• Purpose: All in one plasmid that expresses Csy4, S.pyogenes FokI-dCas9-NLS, and GFP. Also encodes for multiplexed gRNAs. Backbone derived from pSQT1601 (Addgene #53369).
• Depositing Lab: Lawrence Stanton
• Publication: Havlicek et al Mol Ther. 2017 Feb 1;25(2):342-355. doi: 10.1016/j.ymthe.2016.11.007.

Backbone

• Vector backbone: pSQT-1601
• Backbone manufacturer: Shengdar Q Tsai from Keith Joung lab
• Backbone size w/o insert (bp): 3565
• Total vector size (bp): 10425
• Modifications to backbone: U6-gRNA expression cassette inserted; CAG promoter exchanged for CMV promoter. P2A-GFP insertion added.
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Csy4-T2A-SpRFN-P2A-GFP
• Alt name: FokI-dCas9
• Alt name: RNA-guided FokI-nuclease
• Species: Streptococcus pyogenes
• Insert Size (bp): 6294
• Mutation: D10A, H840A
• Promoter: CMV
• Tags / Fusion Proteins:
  • FokI fusion via 25 amino acid (GGGGS)5 linker (N terminal on insert)
  • GFP (C terminal on backbone)
  • Csy4 (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtttgactcacggggatttc
• 3′ sequencing primer: ttttggcagagggaaaaaga

Gene/Insert 2

• Gene/Insert name: gRNA
• Alt name: guide RNA
• Species: Synthetic
• Insert Size (bp): 148
• Promoter: U6
• Tag / Fusion Protein:
  • Csy4 recognition sequence (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AGGGTTATTGTCTCATGAGCGG

Resource Information

• Supplemental Documents:
  • pSH-Csy4-T2A-SpRFN-P2A-GFP-multi-gRNA.ape
• A portion of this plasmid was derived from a plasmid made by: Modified from pSQT-1601 (Addgene 53369).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry