pSH-Csy4-T2A-SaRFN
(Plasmid #85755)

• Purpose: Expresses S.aureus FokI-dCas9-NLS with a 36 amino acid GSAT linker fusion. Also expresses Csy4 for cleavage of multiplexed gRNA transcripts. Backbone derived from pSQT1601 (Addgene #53369).
• Depositing Lab: Lawrence Stanton
• Publication: Havlicek et al Mol Ther. 2017 Feb 1;25(2):342-355. doi: 10.1016/j.ymthe.2016.11.007.

Backbone

• Vector backbone: pSQT-1601
• Backbone manufacturer: Shengdar Q Tsai from Keith Joung lab
• Backbone size w/o insert (bp): 4833
• Total vector size (bp): 9471
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Csy4-T2A-FokI-SadCas9
• Alt name: RNA-guided FokI-nuclease
• Alt name: SaRFN
• Species: Staphylococcus aureus
• Insert Size (bp): 4638
• Mutation: D10A, N580A
• Promoter: CAG
• Tags / Fusion Proteins:
  • FokI fusion via 36 amino acid GSAT linker (N terminal on insert)
  • Csy4 (N terminal on backbone)
  • 3xHA tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AGAGCCTCTGCTAACCATGTTC
• 3′ sequencing primer: ttttggcagagggaaaaaga

Resource Information

• Supplemental Documents:
  • pSH-Csy4-T2A-SaRFN.ape
• A portion of this plasmid was derived from a plasmid made by: S.a. Cas9 derived from plasmid pX601 (Addgene 61591).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry