TRE-KRAB-dCas9-IRES-GFP
(Plasmid #85556)

• Purpose: 2nd generation lentiviral vector expressing a KRAB-dCas9 fusion protein and GFP
• Depositing Lab: Eric Lander
• Publication: Fulco et al Science. 2016 Sep 29. pii: aag2445.

Backbone

• Vector backbone: pHR
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 8812
• Total vector size (bp): 14627
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: GFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KRAB-dCas9-IRES-GFP
• Species: Synthetic
• Insert Size (bp): 5815
• Promoter: TRE3G
• Tags / Fusion Proteins:
  • KRAB domain (N terminal on insert)
  • HA Tag (C terminal on insert)
  • 2x NLS (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: pHR-F TTACAGGGACAGCAGAGATC
• 3′ sequencing primer: WPRE-R CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • Annotated GenBank file
• A portion of this plasmid was derived from a plasmid made by: Jonathan Weissman (Addgene #60954)
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry