FgH1tUTG_hup53_Ex5
(Plasmid #85539)

• Purpose: Inducible expression of guide RNA (hup53_Ex5) with fluorescent GFP reporter
• Depositing Lab: Marco Herold
• Publication: (unpublished)

Backbone

• Vector backbone: FUGW
• Backbone manufacturer: David Baltimore
• Total vector size (bp): 10957
• Vector type: Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hup53 Ex5
• gRNA/shRNA sequence: TCCCGAGCGCTGCTCAGATAGCGA
• Species: H. sapiens (human)
• Promoter: H1t

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmB1 (destroyed during cloning)
• 3′ cloning site: BsmB1 (destroyed during cloning)
• 5′ sequencing primer: CAGACATACAAACTAAAGAAT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The human p53 Ex5 has been used in the following paper:

Gut

2015 Oct;64(10):1506-16. doi: 10.1136/gutjnl-2015-309770. Epub 2015 Jul 17.

APR-246 potently inhibits tumour growth and overcomes chemoresistance in preclinical models of oesophageal adenocarcinoma.
Liu DS1, Read M1, Cullinane C2, Azar WJ3, Fennell CM4, Montgomery KG4, Haupt S5, Haupt Y5, Wiman KG6, Duong CP7, Clemons NJ1, Phillips WA8.