FgH1tUTG_hup53_Ex4
(Plasmid
#85538)
-
PurposeInducible expression of guide RNA (hup53_Ex4) with fluorescent GFP reporter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85538 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneFUGW
-
Backbone manufacturerDavid Baltimore
- Total vector size (bp) 10957
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehup53 Ex4
-
gRNA/shRNA sequenceTCCCGGCAGCTACGGTTTCCGTCT
-
SpeciesH. sapiens (human)
- Promoter H1t
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmB1 (destroyed during cloning)
- 3′ cloning site BsmB1 (destroyed during cloning)
- 5′ sequencing primer CAGACATACAAACTAAAGAAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FgH1tUTG_hup53_Ex4 was a gift from Marco Herold (Addgene plasmid # 85538 ; http://n2t.net/addgene:85538 ; RRID:Addgene_85538)