pDule-tfmF A65V S158A
(Plasmid #85484)

• Purpose: Machinery plasmid expressing permissive Mj tfmF synthetase and cognate amber suppressing tRNA
• Depositing Lab: Ryan Mehl
• Publication: Miyake-Stoner et al Biochemistry. 2010 Mar 2;49(8):1667-77. doi: 10.1021/bi901947r.

Backbone

• Vector backbone: pDule
• Backbone size w/o insert (bp): 5400
• Total vector size (bp): 6300
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: tri-fluoromethyl-phenylalanine Mj synthetase A65V S158A
• Alt name: tfmF A65V S158A
• Species: Methanocaldococcus jannaschii
• Insert Size (bp): 921
• Mutation: Y32V F108W Q109M I159M with 65Val and 158Ala
• Promoter: lpp (constitutive)
• Tag / Fusion Protein:
  • None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CGTCACTGCGTCTTTTACTG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry