Skip to main content
Addgene

pAAV-RSV-SpCas9
(Plasmid #85450)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85450 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pRSV
  • Promoter pRSV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer CGGTCTAGAaatgtagtcttatgcaatac
  • 3′ sequencing primer CGGACCGGTTTTATGTATCGAGCTAGGCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We purchased a lentiviral vector with shRNA-MDM2 from GE Dharmacon (Lafayette, CO)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We replaced the pMecp2 promoter of SpCas9 (Addgene: 60957) with a RSV (Rous Sarcoma Virus) promoter, which was amplified from a lentiviral vector for shRNA-MDM2

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-RSV-SpCas9 was a gift from Hetian Lei (Addgene plasmid # 85450 ; http://n2t.net/addgene:85450 ; RRID:Addgene_85450)
  • For your References section:

    The CRISPR/Cas9-created MDM2 T309G enhances vitreous-induced expression of MDM2 and proliferation and survival of cells. Duan Y, Ma G, Huang X, D'Amore PA, Zhang F, Lei H. J Biol Chem. 2016 May 31. pii: jbc.M116.729467. 10.1074/jbc.M116.729467 PubMed 27246850