-
PurposeLentiviral vector expressing a KRAB-dCas9 fusion protein and BFP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85449 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 8812
- Total vector size (bp) 14609
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKRAB-dCas9-IRES-BFP
-
SpeciesSynthetic
-
Insert Size (bp)5797
- Promoter TRE3G
-
Tags
/ Fusion Proteins
- KRAB domain (N terminal on insert)
- HA Tag (C terminal on insert)
- 2x NLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer pHR-F TTACAGGGACAGCAGAGATC
- 3′ sequencing primer WPRE-R CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byJonathan Weissman (Addgene #60954)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRE-KRAB-dCas9-IRES-BFP was a gift from Eric Lander (Addgene plasmid # 85449 ; http://n2t.net/addgene:85449 ; RRID:Addgene_85449) -
For your References section:
Systematic mapping of functional enhancer-promoter connections with CRISPR interference. Fulco CP, Munschauer M, Anyoha R, Munson G, Grossman SR, Perez EM, Kane M, Cleary B, Lander ES, Engreitz JM. Science. 2016 Sep 29. pii: aag2445. 10.1126/science.aag2445 PubMed 27708057